This FastAPI API provides the answers to problems in the Rosalind problem set.
A deployed version of this API can be found here hosted on Azure. You can view the docs and test out some of the endpoints there.
Don't cheat!
I set this up as a personal project to explore FastAPI and solve some of the Rosalind problems. While you could use this to cheat on the Rosalind problems, I urge you not to. The whole point of the Rosalind problem set is to learn the algorithms and concepts behind some bioinformatics problems.
All endpoints accept POST requests with multipart/form-data as the body. This data should be just one text/plain file. You can hit this endpoint using requests like this:
import requests
local_filepath = "./path/to/local/file.txt"
url = "https://boone-rosalind.azurewebsites.net/problems/dna"
with open(local_filepath, 'rb') as file:
files = {"file": file}
response = requests.post(url, files=files)
print(response.json())If you have the dataset as a string, you can use StringIO to create a file-like object:
import requests
import io
contents = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
url = "https://boone-rosalind.azurewebsites.net/problems/dna"
file = io.StringIO(contents)
files = {"file": file}
response = requests.post(url, files=files)
print(response.json())You can see the format of the file that each endpoint accepts in each endpoint description. The formats match the datasets that Rosalind provides. With a 200 status code, each endpoint will respond with the following json:
// a string
{
"answer": "ACGT"
}
// or a number
{
"answer": 0.5
}You can write the contents of response.json()["answer"] to a file, and that should be the answer that Rosalind expects.
Run:
pytestin the root of this project.
I bootstrap the tests by getting datasets from /app/tests/data and from the docstrings for each path. The output is checked against the corresponding output in /app/tests/output and the docstring Sample Output.
I don't do any "smart" testing (e.g. test if floats are close to each other). Instead of writing a specific test for each endpoint I thought it was easier to use the datasets provided by Rosalind. To deal with the float issue, I round all floats in the outputs to 4 decimal places and then truncate to 3 decimal places. That way I can compare the rounded floats found in the docstrings to actual results. I don't want to do any rounding when I return from my endpoints.