a toolbox to analyze sequences, structures and simulations of RNA
Look for other our projects at https://github.com/RNA-Puzzles.
A core library and a set of programs to run various Python functions related to work, initially, with PDB files of RNA structures, but right now this is a huge toolbox of tools to process various types of RNA data.
That is why in 2019, after publishing our U6 Molecular Cell paper I decided to rename the package to rna-tools. Simply, various tools to work with RNA data: sequences, alignments, structures, trajectories, RNA-seq data. If you want access the old version see the branch.
The software is used by me in my servers NPDock (RNA/DNA-protein docking method, http://genesilico.pl/NPDock/) and SimRNAweb (RNA 3D structure prediction method, http://iimcb.genesilico.pl/SimRNAweb/) and mqapRNA (RNA 3D quality control, http://iimcb.genesilico.pl/mqapRNA/) and other projects EvoClustRNA and RNA-Puzzles-Normalized-submissions.
What is fun here?
rna-tools (formerly rna-pdb-tools) is a packages of shell utils that are using the common core library. You can also access functions of the library from your scripts.
A command-line tools:
$ rna_pdb_toolsx.py --is_pdb input/1I9V_A.pdb
True
$ rna_pdb_toolsx.py --is_pdb input/image.png
Falseor from a script:
>>> from rna_tools_lib import *
>>> s = RNAStructure('input/1I9V_A.pdb')
>>> s.is_pdb()
Trueor from a Jupyter Notebook:
Fig. Fetch an alignment and generate an RChie plot for it. See more https://github.com/mmagnus/rna-tools/blob/master/rna_tools/tools/rna_alignment/rna_alignment.ipynb
Take a tour http://mmagnus.github.io/rna-tools/#/ and/or read the doc rna-tools.rtfd.io/en/latest/.
Fig. rna_pdb_toolsx.py --get_rnapuzzle_ready *pdb --inplace
- Tour
- rna_pdb_toolsx.py
- Tools
- Docs
- Cite
- Used in papers
- RNA Puzzle Submission
- Inspiration (and alternatives)
- Install
Take a tour http://mmagnus.github.io/rna-tools/#/
usage: rna_pdb_toolsx.py [-h] [--version] [-r] [--delete-anisou]
[--split-alt-locations] [-c] [--is_pdb] [--is_nmr]
[--un_nmr] [--orgmode] [--get_chain GET_CHAIN]
[--fetch] [--fetch_ba] [--get_seq] [--compact]
[--get_ss] [--rosetta2generic]
[--get_rnapuzzle_ready] [--rpr] [--no_hr]
[--renumber_residues] [--dont_rename_chains]
[--dont_fix_missing_atoms]
[--dont_report_missing_atoms] [--collapsed_view]
[--cv] [-v] [--replace_hetatm] [--inplace]
[--mutate MUTATE] [--edit EDIT]
[--rename-chain RENAME_CHAIN]
[--replace-chain REPLACE_CHAIN] [--delete DELETE]
[--extract EXTRACT] [--uniq] [--chain-first]
[--oneline] [--fasta]
file [file ...]
rna_pdb_toolsx - a swiss army knife to manipulation of RNA pdb structures
Tricks:
for i in *pdb; do rna_pdb_toolsx.py --get_rnapuzzle_ready $i > ${i/.pdb/_rpr.pdb}; done
Usage::
$ for i in *pdb; do rna_pdb_toolsx.py --delete A:46-56 $i > ../rpr_rm_loop/$i ; done
$ rna_pdb_toolsx.py --get_seq *
# BujnickiLab_RNApuzzle14_n01bound
> A:1-61
# BujnickiLab_RNApuzzle14_n02bound
> A:1-61
CGUUAGCCCAGGAAACUGGGCGGAAGUAAGGCCCAUUGCACUCCGGGCCUGAAGCAACGCG
[...]
positional arguments:
file file
optional arguments:
-h, --help show this help message and exit
--version
-r, --report get report
--delete-anisou remove files with ANISOU records, works with --inplace
--split-alt-locations
@todo
-c, --clean get clean structure
--is_pdb check if a file is in the pdb format
--is_nmr check if a file is NMR-style multiple model pdb
--un_nmr Split NMR-style multiple model pdb files into individual models [biopython]
--orgmode get a structure in org-mode format <sick!>
--get_chain GET_CHAIN
get chain, .e.g A
--fetch fetch file from the PDB db
--fetch_ba fetch biological assembly from the PDB db
--get_seq get seq
--compact with --get_seq, get it in compact view'
$ rna_pdb_toolsx.py --get_seq --compact *.pdb
# 20_Bujnicki_1
ACCCGCAAGGCCGACGGCGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU # A:1-68
# 20_Bujnicki_2
ACCCGCAAGGCCGACGGCGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU # A:1-68
# 20_Bujnicki_3
ACCCGCAAGGCCGACGGCGCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU # A:1-68
# 20_Bujnicki_4
--get_ss get secondary structure
--rosetta2generic convert ROSETTA-like format to a generic pdb
--get_rnapuzzle_ready
get RNApuzzle ready (keep only standard atoms).'
Be default it does not renumber residues, use --renumber_residues
[requires BioPython]
--rpr alias to get_rnapuzzle ready)
--no_hr do not insert the header into files
--renumber_residues by defult is false
--dont_rename_chains used only with --get_rnapuzzle_ready.
By default:
--get_rnapuzzle_ready rename chains from ABC.. to stop behavior switch on this option
--dont_fix_missing_atoms
used only with --get_rnapuzzle_ready
--dont_report_missing_atoms
used only with --get_rnapuzzle_ready
--collapsed_view
--cv alias to collapsed_view
-v, --verbose tell me more what you're doing, please!
--replace_hetatm replace 'HETATM' with 'ATOM' [tested only with --get_rnapuzzle_ready]
--inplace in place edit the file! [experimental,
only for get_rnapuzzle_ready, delete, get_ss, get_seq]
--mutate MUTATE mutate residues,
e.g. A:1A+2A+3A+4A,B:1A to mutate the first nucleotide of the A chain to Adenine
etc and the first nucleotide of the B chain
--edit EDIT edit 'A:6>B:200', 'A:2-7>B:2-7'
--rename-chain RENAME_CHAIN
edit 'A>B' to rename chain A to chain B
--replace-chain REPLACE_CHAIN
a file PDB name with one chain that will be used to
replace the chain in the original PDB file,
the chain id in this file has to be the same with the chain id of the original chain
--delete DELETE delete the selected fragment, e.g. A:10-16, or for more than one fragment --delete 'A:1-25+30-57'
--extract EXTRACT extract the selected fragment, e.g. A:10-16, or for more than one fragment --extract 'A:1-25+30-57'
--uniq
rna_pdb_toolsx.py --get_seq --uniq '[:5]' --compact --chain-first * | sort
A:1-121 ACCUUGCGCAACUGGCGAAUCCUGGGGCUGCCGCCGGCAGUACCC...CA # rp13nc3295_min.out.1
A:1-123 ACCUUGCGCGACUGGCGAAUCCUGAAGCUGCUUUGAGCGGCUUCG...AG # rp13cp0016_min.out.1
A:1-123 ACCUUGCGCGACUGGCGAAUCCUGAAGCUGCUUUGAGCGGCUUCG...AG # zcp_6537608a_ALL-000001_AA
A:1-45 57-71 GGGUCGUGACUGGCGAACAGGUGGGAAACCACCGGGGAGCGACCCGCCGCCCGCCUGGGC # solution
--chain-first
--oneline
--fasta with --get-seq, show sequences in fasta format,
can be combined with --compact (mind, chains will be separated with ' ' in one line)
$ rna_pdb_toolsx.py --get_seq --fasta --compact input/20_Bujnicki_1.pdb
> 20_Bujnicki_1
ACCCGCAAGGCCGACGGC GCCGCCGCUGGUGCAAGUCCAGCCACGCUUCGGCGUGGGCGCUCAUGGGU
Tricks:
$ for i in *; do echo $i; rna_pdb_toolsx.py --delete A:48-52 $i > noloop/${i/.pdb/_noloop.pdb}; done
10_rp17c.out.14.pdb
10_rp17c.out.14_out.pdb
[..]
$ for i in *.pdb; do rna_pdb_toolsx.py --c $i > ${i/.pdb/_clx.pdb}; done
$ for i in *.pdb; do rna_pdb_toolsx.py --get_rnapuzzle_ready $i > ${i/.pdb/_rpr.pdb}; done
.. keep original structures in original and use rpr:
➜ bujnicki_server_ss for i in original/*.pdb; do rna_pdb_toolsx.py --get_rnapuzzle_ready $i > ${i/.pdb/_rpr.pdb}; done
➜ bujnicki_server_ss ls
17pz_withSS_all_thrs6.00A_clust01-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust06-000001_AA_rpr.pdb
17pz_withSS_all_thrs6.00A_clust02-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust07-000001_AA_rpr.pdb
17pz_withSS_all_thrs6.00A_clust03-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust08-000001_AA_rpr.pdb
17pz_withSS_all_thrs6.00A_clust04-000001_AA_rpr.pdb 17pz_withSS_all_thrs6.00A_clust09-000001_AA_rpr.pdb
17pz_withSS_all_thrs6.00A_clust05-000001_AA_rpr.pdb original
.. or to get SimRNAready structures:
$ for i in *pdb; do rna_pdb_toolsx.py --get_simrna_ready $i > ${i/.pdb/_srr.pdb}; done
See Tools for simple but still extremly powerful rna tools.
Read more http://rna-tools.readthedocs.io/en/latest/
Read the documentations at rna-tools.rtfd.io/en/latest/.
Magnus, M., Antczak, M., Zok, T., Wiedemann, J., Lukasiak, P., Bujnicki, J. M., et al. (2019). RNA-Puzzles toolkit: A computational resource of RNA 3D structure benchmark datasets, structure manipulation and evaluation tools. (in preparation)
-
Eysmont, K., Matylla-Kulinska, K., Jaskulska, A., Magnus, M., & Konarska, M. M. (2018). Rearrangements within the U6 snRNA core at the transition between the two catalytic steps of splicing. Molecular Cell (in press)
-
Li, J., Zhu, W., Wang, J., Li, W., Gong, S., Zhang, J., & Wang, W. (2018). RNA3DCNN: Local and global quality assessments of RNA 3D structures using 3D deep convolutional neural networks. PLoS Computational Biology, 14(11), e1006514. http://doi.org/10.1371/journal.pcbi.1006514
-
Boccaletto, P., Magnus, M., Almeida, C., Zyła, A., Astha, A., Pluta, R., et al. (2018). RNArchitecture: a database and a classification system of RNA families, with a focus on structural information. Nucleic Acids Research, 46(D1), D202–D205. http://doi.org/10.1093/nar/gkx966
-
Magnus, M., Boniecki, M. J., Dawson, W. K., & Bujnicki, J. M. (2016). SimRNAweb: a web server for RNA 3D structure modeling 4with optional restraints. Nucleic Acids Research, 44(W1), W315–9. http://doi.org/10.1093/nar/gkw279
-
Tuszyńska, I., Magnus, M., Jonak, K., Dawson, W. K., & Bujnicki, J. M. (2015). NPDock: a web server for protein-nucleic acid docking. Nucleic Acids Research, 43(W1), W425–30. http://doi.org/10.1093/nar/gkv493
Read at https://rna-tools.readthedocs.io/en/latest/rna-puzzles.html
- https://www.rosettacommons.org/docs/latest/application_documentation/rna/RNA-tools
- http://blue11.bch.msu.edu/mmtsb/convpdb.pl
- https://github.com/haddocking/pdb-tools
- https://github.com/harmslab/pdbtools
- http://ginsberg.med.virginia.edu/Links/Phenix/pdbtools.htm
- .. and more!
Read at http://rna-tools.readthedocs.io/en/latest/install.html



