rna-toys / quizzes / playground / tutorials

Note

(hmm... it's more like quizzes, because I'm not giving excellent explanations ;-) So maybe it's not tutorials ;-))

rna-tutorials is a hands-on repository with shell scripts and command examples demonstrating practical RNA analysis workflows and basic Infernal/RNA-tools usage, aimed at education and reproducible tutorials.

1. Make a sequence alignments of two RNA sequences (infernal-align-two-seqs-to-rfam-model), the two tRNA molecules share an almost identical 3D fold despite only 63% sequence identity in their aligned regions #infernal #rfam
2. Calculate RMSD between two structures of homologs? (rna-3d-rmsd-for-tRNAs) - 3D structural alignment between two tRNA molecules #pymol #infernal #rfam
3. Secondary structure, returns matrix of interactions¹ (secondary-structure-interaction-arrays) #python #numpy
4. Get secondary structure for tRNA (1ehz) #rnatools
   • using frabase (https://rnafrabase.cs.put.poznan.pl)
5. Annotate secondary strucure for tetraloop_steamOf1bp.pdb (with rna-tools.online) #rnatools

RNA Edit

#TODO add extract with rna-tools

Tips

• see all tRNA structures - https://rfam.org/family/RF00005#tabview=tab6

Tools

rna-tools

https://rna-tools.readthedocs.io/

rna-tools: a toolbox to analyze structures and simulations of RNA

RNA-Puzzles toolkit: A computational resource of RNA 3D structure benchmark datasets, structure manipulation, and evaluation tools.
M. Magnus, M. Antczak, P. Lukasiak, J. Wiedemann, T. Zok, J. M. Bujnicki, E. Westhof, M. Szachniuk, and Z. Miao
Nucleic Acid Research, vol. 48, no. 2, pp. 576–588, Jan. 2020

rna-tools in colab https://colab.research.google.com/drive/1PsnQRAKbIhKGuxmhiZ5fSeBkjfQRieSS?usp=sharing

rna-tools.online

https://rna-tools.online

rna-tools.online is an online gateway to some of the rna-tools functionalities

rna-tools.online – a Swiss army knife for RNA 3D modeling workflows  
M. Magnus  
Nucleic Acid Research, 10.1093/nar/gkac372, May 2022  

emacs-pdb-mode

Emacs for editing files in the PDB format https://github.com/mmagnus/emacs-pdb-mode

Examplary inputs

>1ehz (tRNA)
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....)))))))))))).... 
# ss from https://rnafrabase.cs.put.poznan.pl/?act=pdbdetails&id=1EHZ

https://www.rcsb.org/structure/1EHZ

Footnotes

1. https://rna-tools.readthedocs.io/en/latest/_modules/rna_tools/SecondaryStructure.html#parse_vienna_to_pairs ↩